thatsocaroline thatsocaroline

10-04-2017
Mathematics

contestada

Which type of polygon can never be equiangular?
A) parallelogram
B) obtuse triangle
C) pentagon
D) equilateral octagon

Respuesta :

Аноним Аноним

22-04-2017

I believe the correct answer would be an obtuse angle. It is the polygon that would never have equal angles since one of the angles has a measure greater than 90 the other angle are acute or less than 90. Hope this answers the question.

Answer Link

Otras preguntas

which attribution model distributes the credit for a conversion equally across all the channels a customer clicked or engaged with before converting?linear

describe one consumer issue that candidates for georgia senate and georgia governor have mentioned during their campaigns and plan to address if elected?

what is 7 is ... of 12 ?

Write an equation of the line that passes through the points (-1,7) (6,7)

true or false? it is permissible to use dot-dot notation such as // alpha[i. . . j] have been printed to specify a range of array elements even though dot dot n

the pap test for cervical cancer involves microscopic examination of cervical cells for cancerous cells. a new, rapid diagnostic test to detect human papilloma

#21 Under HIPAA, which of the following is not named as a covered entity? A. Outsourced transcription company B. Health plan C. Healthcare clearinghouse D. Heal

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

Kehlani launches a toy rocket from a platform. The height of the rocket in feet is given by h= -16t^2 + 72t + 144 where t represents the time in seconds after l

Order the numbers from least to greatest. The numbers are 0.4, 5/8, and 38% Please write in this format :) Least _____ Middle _____ Greatest ______